Use my Search Websuite to scan PubMed, PMCentral, Journal Hosts and Journal Archives, FullText.
Kick-your-searchterm to multiple Engines kick-your-query now !>
A dictionary by aggregated review articles of nephrology, medicine and the life sciences
Your one-stop-run pathway from word to the immediate pdf of peer-reviewed on-topic knowledge.

suck abstract from ncbi


10.1016/j.gene.2021.145839

http://scihub22266oqcxt.onion/10.1016/j.gene.2021.145839
suck pdf from google scholar
34274470!8282474!34274470
unlimited free pdf from europmc34274470    free
PDF from PMC    free
html from PMC    free

Warning: file_get_contents(https://eutils.ncbi.nlm.nih.gov/entrez/eutils/elink.fcgi?dbfrom=pubmed&id=34274470&cmd=llinks): Failed to open stream: HTTP request failed! HTTP/1.1 429 Too Many Requests in C:\Inetpub\vhosts\kidney.de\httpdocs\pget.php on line 215

suck abstract from ncbi


Deprecated: Implicit conversion from float 231.6 to int loses precision in C:\Inetpub\vhosts\kidney.de\httpdocs\pget.php on line 534

Deprecated: Implicit conversion from float 231.6 to int loses precision in C:\Inetpub\vhosts\kidney.de\httpdocs\pget.php on line 534

Deprecated: Implicit conversion from float 231.6 to int loses precision in C:\Inetpub\vhosts\kidney.de\httpdocs\pget.php on line 534

Deprecated: Implicit conversion from float 231.6 to int loses precision in C:\Inetpub\vhosts\kidney.de\httpdocs\pget.php on line 534

Warning: imagejpeg(C:\Inetpub\vhosts\kidney.de\httpdocs\phplern\34274470.jpg): Failed to open stream: No such file or directory in C:\Inetpub\vhosts\kidney.de\httpdocs\pget.php on line 117
pmid34274470      Gene 2021 ; 800 (�): 145839
Nephropedia Template TP

gab.com Text

Twit Text FOAVip

Twit Text #

English Wikipedia


  • Therapeutic perceptions in antisense RNA-mediated gene regulation for COVID-19 #MMPMID34274470
  • de Jesus SF; Santos LI; Rodrigues Neto JF; Vieira TM; Mendes JB; D'angelo MFSV; Guimaraes ALS
  • Gene 2021[Oct]; 800 (�): 145839 PMID34274470show ga
  • COVID-19 was first reported in Wuhan, China, in December 2019. It is widely accepted that the world will not return to its prepandemic normality until safe and effective vaccines are available and a global vaccination program has been successfully implemented. Antisense RNAs are single-stranded RNAs that occur naturally or are synthetic and enable hybridizing and protein-blocking translation. Therefore, the main objective of this study was to identify target markers in the RNA of the severe acute respiratory syndrome coronavirus, or SARS-CoV-2, with a length between 21 and 28 bases that could enable the development of vaccines and therapies based on antisense RNA. We used a search algorithm in C language to compare 3159 complete nucleotide sequences from SARS-CoV-2 downloaded from the repository of the National Center for Biotechnology Information. The objective was to verify whether any common sequences were present in all 3159 strains of SARS-CoV-2. In the first of three datasets (SARS-CoV-2), the algorithm found two sequences each of 21 nucleotides (Sequence 1: CTACTGAAGCCTTTGAAAAAA; Sequence 2: TGTGGTTATACCTACTAAAAA). In the second dataset (SARS-CoV) and third dataset (MERS-CoV), no sequences of size N between 21 and 28 were found. Sequence 1 and Sequence 2 were input into BLAST(R) >> blastn and recognized by the platform. The gene identified by the sequences found by the algorithm was the ORF1ab region of SARS-CoV-2. Considerable progress in antisense RNA research has been made in recent years, and great achievements in the application of antisense RNA have been observed. However, many mechanisms of antisense RNA are not yet understood. Thus, more time and money must be invested into the development of therapies for gene regulation mediated by antisense RNA to treat COVID-19 as no effective therapy for this disease has yet been found.
  • |Algorithms[MESH]
  • |COVID-19/*genetics/virology[MESH]
  • |Computer Simulation[MESH]
  • |Gene Expression Regulation, Viral[MESH]
  • |Humans[MESH]
  • |RNA, Antisense/*genetics[MESH]


  • DeepDyve
  • Pubget Overpricing
  • suck abstract from ncbi

    Linkout box